Detail of EST/Unigene EW701232 |
Acc. | EW701232 |
Internal Acc. | EST00972 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-17; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-16; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-16; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=1e-16; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-16; |
Length | 213 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_019973; |
Sequence | TAAAAATGGTAGGTTGGCTATGTTTTCCATGTTTGGATTCTTTGTTCAAGCCATTGTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |