| Detail of EST/Unigene EY050795 |
| Acc. | EY050795 |
| Internal Acc. | CATC2797.fwd |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-78; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=7e-78; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=5e-77; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-77; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=1e-76; |
| Length | 459 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_GTRI3; |
| Sequence | CGGGGTTAAGTTCGGTGAGGCTGTTTGGTTCAAGGCTGGAGCCCAGATCTTTAGCGAAGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815055 |
| Trichome-related Gene from Literature | N/A |