Detail of EST/Unigene EY056006 |
Acc. | EY056006 |
Internal Acc. | CATC791.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-97; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-97; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=6e-97; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=8e-97; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=8e-97; |
Length | 533 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI3; |
Sequence | ACCGTGTCAAGTACCTAGGCCCATTCTCTGGTGAGGCTCCATCATACCTCACTGGTGAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |