Detail of EST/Unigene EY067080 |
Acc. | EY067080 |
Internal Acc. | CATF9657.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-68; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=4e-68; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=5e-68; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-68; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=8e-68; |
Length | 540 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_GTRI4; |
Sequence | ACAAATATCCAGTGAAGGTGGACTTGACTACTTGGGTAACCCAAGTTTGGTCCATGCACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |