Detail of EST/Unigene EY073883 |
Acc. | EY073883 |
Internal Acc. | CAZI10966.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=9e-67; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-66; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=4e-65; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=3e-64; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=5e-64; |
Length | 713 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | AACCTTGCAATCCGTACTCAATATTATTTGATTTACAATCCAAGCGAATGGTTGGATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |