| Detail of EST/Unigene EY084363 |
| Acc. | EY084363 |
| Internal Acc. | CAZI16323.rev |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 687 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI; |
| Sequence | GCCCAAAATTAAACCATATATTACTAATAATAATTCACAAACAATATGACATCAATAAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |