| Detail of EST/Unigene EY088801 |
| Acc. | EY088801 |
| Internal Acc. | CAZI18567.fwd |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase (Fragment) OS=Vigna radiata var. radiata E-value=0; 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=0; 1-aminocyclopropane-1-carboxylate synthase 6 OS=Arabidopsis thaliana E-value=0; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=0; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=0; |
| Length | 824 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI; |
| Sequence | GAATTTAGAGAGGCGATTGCTAACTTCATGAGTCGAGTTAGAGGAAGTCGTGCGAAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826730 |
| Trichome-related Gene from Literature | 826730 |