Detail of EST/Unigene EY089194 |
Acc. | EY089194 |
Internal Acc. | CAZI1877.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-92; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-90; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-88; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=4e-88; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=4e-85; |
Length | 775 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | GATAAAAAGGCAGGTACTACTATACACTCGCCGGCTGTCGACACCGCCGCTGGATAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |