Detail of EST/Unigene EY091537 |
Acc. | EY091537 |
Internal Acc. | CAZI19927.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=5e-42; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=4e-41; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=7e-41; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=1e-40; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=2e-40; |
Length | 548 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | ACAATTATGAGCTTCATAACTTTGAACACTAATTGAAATCCACACATAAGCTGGCATTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |