| Detail of EST/Unigene EY096544 |
| Acc. | EY096544 |
| Internal Acc. | CAZI22785.rev |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=8e-82; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=1e-77; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-76; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=6e-74; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=7e-73; |
| Length | 761 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI; |
| Sequence | ATGATAAATCAAAATAAAATATAATGTTTCAAGTTTCAACATACTCATTAGAAGCAATTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836542 |
| Trichome-related Gene from Literature | 836542 |