Detail of EST/Unigene EY096545 |
Acc. | EY096545 |
Internal Acc. | CAZI22785.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=3e-85; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=1e-84; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-80; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=3e-76; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-75; |
Length | 747 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | TGATCCAACCAAATCACGTAAAAATGAACCGAATACTTGCGAATTCGACGTTACGTAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |