Detail of EST/Unigene EY101156 |
Acc. | EY101156 |
Internal Acc. | CAZI25130.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-CoA carboxylase 1 OS=Arabidopsis thaliana E-value=1e-46; Acetyl-CoA carboxylase 2 OS=Arabidopsis thaliana E-value=1e-45; Acetyl-CoA carboxylase 1 OS=Oryza sativa subsp. japonica E-value=8e-41; Acetyl-CoA carboxylase 2 OS=Oryza sativa subsp. japonica E-value=3e-39; Acetyl-CoA carboxylase 2 OS=Homo sapiens E-value=2e-14; |
Length | 679 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | ACAAAAAAAATACTAAGGATATATAATTATGTAATGCTTAAAAATTGTAATTGTATTTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K01946 biotin carboxylase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K11262 acetyl-CoA carboxylase |
EC | 6.3.4.14 6.4.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840521 |
Trichome-related Gene from Literature | 840521 |