Detail of EST/Unigene EY102802 |
Acc. | EY102802 |
Internal Acc. | CAZI2595.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=3e-76; 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=9e-75; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=1e-73; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=2e-73; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=1e-72; |
Length | 703 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (1 ESTs); |
Sequence | GTTTAAGGTTTCTTTTTTTCTTCGTCTCAAAATAACAGTTCATTTAACCGATTGCGATGG |
EST members of Unigene | EY102802 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.1 6.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |