Detail of EST/Unigene EY104871 |
Acc. | EY104871 |
Internal Acc. | CAZI3956.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH4 OS=Arabidopsis thaliana E-value=5e-64; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH5 OS=Arabidopsis thaliana E-value=2e-34; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH6 OS=Arabidopsis thaliana E-value=4e-33; Histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 OS=Arabidopsis thaliana E-value=3e-31; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Arabidopsis thaliana E-value=4e-29; |
Length | 701 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI (1 ESTs); |
Sequence | CACATATGACGGCTTGTACAAGGTAGACAGCTACCAGCTTGATGAAGGTAAATCCGGTTT |
EST members of Unigene | EY104871 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K11420 euchromatic histone-lysine N-methyltransferase |
EC | 2.1.1.43 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831244 |
Trichome-related Gene from Literature | 831244 |