Detail of EST/Unigene EY111054 |
Acc. | EY111054 |
Internal Acc. | CAZI7125.rev |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=9e-41; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=2e-40; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=3e-39; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GGIB50 OS=Nicotiana tabacum E-value=5e-39; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana tabacum E-value=5e-39; |
Length | 507 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | GCACAAAAAAAACATGATATTGTTTATTTTACAAGAAGAGATACATAAGCATATGATGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |