| Detail of EST/Unigene EY111054 |
| Acc. | EY111054 |
| Internal Acc. | CAZI7125.rev |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=9e-41; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=2e-40; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=3e-39; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GGIB50 OS=Nicotiana tabacum E-value=5e-39; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana tabacum E-value=5e-39; |
| Length | 507 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI; |
| Sequence | GCACAAAAAAAACATGATATTGTTTATTTTACAAGAAGAGATACATAAGCATATGATGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |