| Detail of EST/Unigene EY111055 |
| Acc. | EY111055 |
| Internal Acc. | CAZI7125.fwd |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=8e-29; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=1e-26; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=9e-26; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=4e-25; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-24; |
| Length | 326 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAZI; |
| Sequence | CTGCACTTCTTCTTTTGGGTCTGCTTGTAGCATTCTTAGATAAAACAGAAGCACAAGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |