Detail of EST/Unigene EY111055 |
Acc. | EY111055 |
Internal Acc. | CAZI7125.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lichenase OS=Nicotiana plumbaginifolia E-value=8e-29; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=1e-26; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=9e-26; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=4e-25; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-24; |
Length | 326 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | CTGCACTTCTTCTTTTGGGTCTGCTTGTAGCATTCTTAGATAAAACAGAAGCACAAGTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |