Detail of EST/Unigene EY111864 |
Acc. | EY111864 |
Internal Acc. | CAZI7550.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FtsH OS=Porphyra purpurea E-value=0; |
Length | 791 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | GCCGGTGTTCCATTTTTCTCGATTTCGGGTTCAGAATTTGTTGAAATGTTTGTTGGTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.24.- 3.6.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817646 |
Trichome-related Gene from Literature | 817646 |