Detail of EST/Unigene EY112982 |
Acc. | EY112982 |
Internal Acc. | CAZI8119.fwd |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-96; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-92; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-91; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-88; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-87; |
Length | 738 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAZI; |
Sequence | TTGAGTAATCTCAAATGGCTACATGGGTCATATCAGAATGTGGTTTAAGACCACTTCCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |