Detail of EST/Unigene FG135074 |
Acc. | FG135074 |
Internal Acc. | AGN_ELP012xh24f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=1e-72; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=2e-62; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=1e-36; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=9e-31; |
Length | 880 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_ELP; |
Sequence | GAAAGAGTTATAGCCGCCCCAGCACACCAAAAAATAATCAAAATCATTCTTGTGACACCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |