| Detail of EST/Unigene FG136432 |
| Acc. | FG136432 |
| Internal Acc. | AGN_ELP008xl10f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=2e-68; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=2e-20; Probable serine/threonine-protein kinase drkD OS=Dictyostelium discoideum E-value=2e-20; Putative serine/threonine-protein kinase/receptor R831 OS=Acanthamoeba polyphaga mimivirus E-value=7e-19; Probable serine/threonine-protein kinase drkB OS=Dictyostelium discoideum E-value=2e-18; |
| Length | 850 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_ELP; |
| Sequence | TTCAGAGAAGTTGAACCAACAATTGATTTCAGGTCATTTGCCAAACAGTATTTCTCAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K06619 proto-oncogene tyrosine-protein kinase ABL1 |
| EC | 2.7.10.- 2.7.10.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831748 |
| Trichome-related Gene from Literature | 831748 |