| Detail of EST/Unigene FG138898 |
| Acc. | FG138898 |
| Internal Acc. | AGN_ELP026xd10f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 750A1 OS=Pinus taeda E-value=1e-32; Cytochrome P450 93A1 OS=Glycine max E-value=2e-30; Cytochrome P450 71B10 OS=Arabidopsis thaliana E-value=1e-29; Cytochrome P450 71A8 OS=Mentha piperita E-value=1e-29; Putative cytochrome P450 71A28 OS=Arabidopsis thaliana E-value=5e-29; |
| Length | 766 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_ELP; |
| Sequence | ATATTGGAGAAACATGCGCAAATTGTGCACTCTGCAATTGCTAAGCAATGCCAAGATCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830580 |
| Trichome-related Gene from Literature | N/A |