Detail of EST/Unigene FG142630 |
Acc. | FG142630 |
Internal Acc. | AGN_RPC021xe24f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-33; Cytochrome P450 71A1 OS=Persea americana E-value=8e-32; Cytochrome P450 750A1 OS=Pinus taeda E-value=2e-31; Cytochrome P450 71B2 OS=Arabidopsis thaliana E-value=1e-30; Cytochrome P450 71B23 OS=Arabidopsis thaliana E-value=5e-30; |
Length | 865 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RPC; |
Sequence | TATCAACTAACAAACACATTGAGTCCTCTCCCAAATCACTGATTCACCACCAAAAGTACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837865 |
Trichome-related Gene from Literature | N/A |