| Detail of EST/Unigene FG142998 |
| Acc. | FG142998 |
| Internal Acc. | AGN_RPC020xm06f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=2e-78; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=9e-77; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=2e-76; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=8e-72; |
| Length | 849 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RPC; |
| Sequence | TGTTCGTAAAAAACCCTTGCTTTATTTCTCTATTTGATATTCGCTAGGGGTAAGGATGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |