Detail of EST/Unigene FG144381 |
Acc. | FG144381 |
Internal Acc. | AGN_RPC015xa13f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=2e-43; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=1e-39; Cytochrome P450 750A1 OS=Pinus taeda E-value=9e-39; Flavonoid 3',5'-hydroxylase OS=Campanula medium E-value=1e-37; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=2e-37; |
Length | 894 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RPC; |
Sequence | TAAAGTACCAACAATTCAATGGAAGGTACAAACTTGACTACATATGCAGCAGTATTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |