| Detail of EST/Unigene FG145204 |
| Acc. | FG145204 |
| Internal Acc. | AGN_RPC013xf15f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=0; |
| Length | 873 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RPC; |
| Sequence | TGATCATTGTCACACAAGCGTGTCATGTTAACAAAGTGAAAGATTATGCTTTGGAGAATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K08748 solute carrier family 27 (fatty acid transporter), member 5 |
| EC | 6.2.1.12 6.2.1.7 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
| Probeset |
|
| Corresponding NCBI Gene | 841593 |
| Trichome-related Gene from Literature | 841593 |