| Detail of EST/Unigene FG148052 |
| Acc. | FG148052 |
| Internal Acc. | AGN_RPC003xo17f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=3e-51; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=5e-46; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=9e-45; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=3e-23; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=1e-21; |
| Length | 479 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RPC; |
| Sequence | AAGAAGAAAGAAAAATGGAAAAAGCTATTGAAAGGCAGAGAGTTCTATTGGAGCACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817876 |
| Trichome-related Gene from Literature | 817876 |