| Detail of EST/Unigene FG150076 |
| Acc. | FG150076 |
| Internal Acc. | AGN_RNC114xc06r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Katanin p80 WD40-containing subunit B1 OS=Danio rerio E-value=3e-08; Uncharacterized WD repeat-containing protein alr3466 OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-06; F-box/WD repeat-containing protein pof11 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-05; F-box/WD repeat-containing protein lin-23 OS=Caenorhabditis elegans E-value=1e-05; Katanin p80 WD40-containing subunit B1 OS=Xenopus laevis E-value=1e-05; |
| Length | 915 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC; |
| Sequence | AGTCACAGAAATTGTTCTTTGTAAAAACTTATAAAGATGCCCCTATAAATTGATCGAGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Transcription > ko03022 Basal transcription factors > K03130 transcription initiation factor TFIID subunit D4; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841327 |
| Trichome-related Gene from Literature | 841327 |