Detail of EST/Unigene FG150938 |
Acc. | FG150938 |
Internal Acc. | AGN_RNC112xl18r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=5e-81; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=8e-81; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=8e-81; Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=7e-80; Trans-cinnamate 4-monooxygenase OS=Arabidopsis thaliana E-value=1e-79; |
Length | 793 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | CGATCTTACAATGAAACTAGTCCAACAAGACTTTCTATAACATAAAAAGAAGAATGTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |