Detail of EST/Unigene FG151863 |
Acc. | FG151863 |
Internal Acc. | AGN_RNC109xb17f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=0; |
Length | 814 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | TTTCATTGGTGCATCGTACCTTGGAGCTATTTCTACAATGGCCAATCCTTTGTTTACGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K08748 solute carrier family 27 (fatty acid transporter), member 5 |
EC | 6.2.1.1 6.2.1.12 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |