Detail of EST/Unigene FG152633 |
Acc. | FG152633 |
Internal Acc. | AGN_RNC107xk09r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=2e-95; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=5e-87; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-85; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-84; |
Length | 870 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | GGCTATGTTACTCTTCTGGGAAAAACGTATGTCCCAGTGTATAAAAATGCTATTTGGAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |