| Detail of EST/Unigene FG152633 |
| Acc. | FG152633 |
| Internal Acc. | AGN_RNC107xk09r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=2e-95; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=5e-87; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-85; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-84; |
| Length | 870 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC; |
| Sequence | GGCTATGTTACTCTTCTGGGAAAAACGTATGTCCCAGTGTATAAAAATGCTATTTGGAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |