| Detail of EST/Unigene FG153165 |
| Acc. | FG153165 |
| Internal Acc. | AGN_RNC106xc18f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=1e-84; Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=7e-84; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=2e-82; dTDP-D-glucose 4,6-dehydratase OS=Mus musculus E-value=9e-41; dTDP-D-glucose 4,6-dehydratase OS=Homo sapiens E-value=7e-39; |
| Length | 752 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC; |
| Sequence | CGTGTATAAATACATACACAAAAGGGAGACGATACAGATACAGATACAGATACGATACTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
| EC | 4.2.1.46 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820707 |
| Trichome-related Gene from Literature | 820707 |