| Detail of EST/Unigene FG154708 |
| Acc. | FG154708 |
| Internal Acc. | AGN_RNC103xn17r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=2e-50; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=4e-50; Cysteine synthase OS=Solanum tuberosum E-value=9e-49; Cysteine synthase OS=Citrullus lanatus E-value=2e-47; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=4e-47; |
| Length | 842 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC; |
| Sequence | GGAGTTTGATGAACAAGCAGCACAGCTCTTGAAATTCCTGTTATAAATCCACTGTCACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821817 |
| Trichome-related Gene from Literature | N/A |