Detail of EST/Unigene FG159858 |
Acc. | FG159858 |
Internal Acc. | AGN_RNC021xh11r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-79; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-74; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=1e-71; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=7e-69; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-68; |
Length | 708 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | ATCTTAATCTAGCTAGATTATTTGTCTCATCATAGACAAAATTCGCAGATATAACTCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |