Detail of EST/Unigene FG171444 |
Acc. | FG171444 |
Internal Acc. | AGN_RNC101xn03r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=9e-72; Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=2e-71; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=5e-71; Shaggy-related protein kinase theta OS=Arabidopsis thaliana E-value=5e-60; Shaggy-related protein kinase theta OS=Brassica napus E-value=1e-59; |
Length | 849 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | CCTCATCTTATAGCAGCCTCTGGCGCCATGGCACAGTCATGTTCATACATTTCATTTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
EC | 2.7.11.26 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817649 |
Trichome-related Gene from Literature | N/A |