| Detail of EST/Unigene FG172305 |
| Acc. | FG172305 |
| Internal Acc. | AGN_RNC128xf17f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=2e-86; Aspartate aminotransferase OS=Pinus pinaster E-value=1e-61; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=1e-60; Aspartate aminotransferase OS=Thermus aquaticus E-value=2e-34; Aspartate aminotransferase A OS=Rhizobium meliloti (strain 1021) E-value=9e-34; |
| Length | 770 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_RNC; |
| Sequence | ATCAATTCAAAACCCAACATTGAAATTGGATATAAATCCCACCAAATGGCTGCTACTACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816758 |
| Trichome-related Gene from Literature | 816758 |