Detail of EST/Unigene FG173564 |
Acc. | FG173564 |
Internal Acc. | AGN_RNC126xn18r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-66; Hydroxymethylglutaryl-CoA synthase 1 OS=Blattella germanica E-value=4e-25; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=7e-22; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Homo sapiens E-value=3e-21; Hydroxymethylglutaryl-CoA synthase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=5e-21; |
Length | 730 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | AACCAAAAAACATTGAATTTGTTGAAAACTAAAAAGGCATTGAACATTAGGGAAAAATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |