Detail of EST/Unigene FG173828 |
Acc. | FG173828 |
Internal Acc. | AGN_RNC125xd01f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=1e-72; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=2e-57; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=5e-57; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=3e-56; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-53; |
Length | 437 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | AATCCTAGTTCTATTGTCCGCGCCGTATCTACGCCAGCAAAGCCAGCTGCAGTGGAGCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830336 |
Trichome-related Gene from Literature | 830336 |