Detail of EST/Unigene FG174243 |
Acc. | FG174243 |
Internal Acc. | AGN_RNC124xe18f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=0; dTDP-D-glucose 4,6-dehydratase OS=Mus musculus E-value=5e-52; dTDP-D-glucose 4,6-dehydratase OS=Dictyostelium discoideum E-value=3e-51; |
Length | 900 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_RNC; |
Sequence | CTCTCATCTTCACACGCTTTTCTCTTTCTCTCTCTAAAAAGTCTCTTCCGTTTCTCTCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
EC | 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820707 |
Trichome-related Gene from Literature | 820707 |