| Detail of EST/Unigene FG192179 |
| Acc. | FG192179 |
| Internal Acc. | AGN_PNL218df1_b10.trimmed.seq |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ent-cassadiene C2-hydroxylase OS=Oryza sativa subsp. japonica E-value=1e-29; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=2e-28; Ent-isokaurene C2-hydroxylase OS=Oryza sativa subsp. japonica E-value=3e-28; Cytochrome P450 84A1 OS=Arabidopsis thaliana E-value=4e-28; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=8e-28; |
| Length | 611 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_PNL; |
| Sequence | AAAAAAGGTACTTGTTCAAAAATAATTTCAACATACTATAGGAAATACAAACAAATGCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Biosynthesis of Secondary Metabolites > ko00981 Insect hormone biosynthesis > K10720 CYP306A1; ecdysteroid 25-hydroxylase |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819163 |
| Trichome-related Gene from Literature | N/A |