Detail of EST/Unigene FG192179 |
Acc. | FG192179 |
Internal Acc. | AGN_PNL218df1_b10.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-cassadiene C2-hydroxylase OS=Oryza sativa subsp. japonica E-value=1e-29; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=2e-28; Ent-isokaurene C2-hydroxylase OS=Oryza sativa subsp. japonica E-value=3e-28; Cytochrome P450 84A1 OS=Arabidopsis thaliana E-value=4e-28; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=8e-28; |
Length | 611 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | AAAAAAGGTACTTGTTCAAAAATAATTTCAACATACTATAGGAAATACAAACAAATGCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Biosynthesis of Secondary Metabolites > ko00981 Insect hormone biosynthesis > K10720 CYP306A1; ecdysteroid 25-hydroxylase |
EC | 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819163 |
Trichome-related Gene from Literature | N/A |