Detail of EST/Unigene FG194191 |
Acc. | FG194191 |
Internal Acc. | AGN_PNL221cf1_b8.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase CTR1 OS=Arabidopsis thaliana E-value=4e-62; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=2e-08; RAF proto-oncogene serine/threonine-protein kinase OS=Pongo abelii E-value=3e-08; RAF proto-oncogene serine/threonine-protein kinase OS=Homo sapiens E-value=3e-08; RAF proto-oncogene serine/threonine-protein kinase OS=Gallus gallus E-value=3e-08; |
Length | 752 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | TGTCGAATTGCGAAAGGATGTAAATATTGTAATAGAGCTGATGCTTCCTCATGTCTAGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831748 |
Trichome-related Gene from Literature | 831748 |