Detail of EST/Unigene FG194405 |
Acc. | FG194405 |
Internal Acc. | AGN_PNL221df1_e5.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=0; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=6e-77; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-47; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-47; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=4e-46; |
Length | 740 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | ATGGCAATCTTTTCCCTACTTCTCTACACTGTCATTTTCTCTTTCCTTCTACATTCCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |