Detail of EST/Unigene FG197810 |
Acc. | FG197810 |
Internal Acc. | AGN_PNL226cf1_a10.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase alpha OS=Arabidopsis thaliana E-value=0; Glycogen synthase kinase-3 homolog MsK-1 OS=Medicago sativa E-value=0; |
Length | 790 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | TCTCTCTCTCTCTCCTCTAACCGACAATTATGATGTTTGAACCTTAAACAAAGCAGAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
EC | 2.7.11.26 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827605 |
Trichome-related Gene from Literature | 827605 |