Detail of EST/Unigene FG200745 |
Acc. | FG200745 |
Internal Acc. | AGN_PNL230cf1_b7.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-2 OS=Solanum tuberosum E-value=0; Hexokinase-1 OS=Nicotiana tabacum E-value=0; Hexokinase-1 OS=Spinacia oleracea E-value=0; Hexokinase-1 OS=Solanum tuberosum E-value=0; Hexokinase-2 OS=Arabidopsis thaliana E-value=0; |
Length | 743 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | TGCTTATCAGCTACGTCGACAATCTCCCCACTGGCGATGAAGAAGGAGTCTTTTATGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816505 |
Trichome-related Gene from Literature | N/A |