Detail of EST/Unigene FG201822 |
Acc. | FG201822 |
Internal Acc. | AGN_PNL232af1_b7.trimmed.seq |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=1e-11; Flavonoid 3',5'-hydroxylase OS=Solanum melongena E-value=4e-10; Cytochrome P450 93A3 OS=Glycine max E-value=5e-10; Cytochrome P450 71A12 OS=Arabidopsis thaliana E-value=6e-10; Cytochrome P450 71A18 OS=Arabidopsis thaliana E-value=8e-10; |
Length | 552 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL; |
Sequence | TCACATTCTGTCTTCTTACAAATCACTGACTCACCAACTAAAATACCAATAATTCAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822237 |
Trichome-related Gene from Literature | N/A |