| Detail of EST/Unigene FG622848 |
| Acc. | FG622848 |
| Internal Acc. | TOBESTR019C08 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-54; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-52; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=2e-46; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=5e-45; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=6e-45; |
| Length | 302 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_023330; |
| Sequence | GCGAATACCTACCCGCCTAAAGATAGTATTTTTCGCGAAGAATTCAAGAGTTTCATTAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |