Detail of EST/Unigene FG623788 |
Acc. | FG623788 |
Internal Acc. | TOBESTR029H12 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-37; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=4e-34; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=6e-26; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=1e-24; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=1e-22; |
Length | 485 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_023330; |
Sequence | TCTTAACATGTGTTACTAACCGAAAGGGAGGGAGGTCGAGCATTTCAAAACCTATCTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |