| Detail of EST/Unigene FG623788 |
| Acc. | FG623788 |
| Internal Acc. | TOBESTR029H12 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=1e-37; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=4e-34; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=6e-26; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=1e-24; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=1e-22; |
| Length | 485 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_023330; |
| Sequence | TCTTAACATGTGTTACTAACCGAAAGGGAGGGAGGTCGAGCATTTCAAAACCTATCTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |