Detail of EST/Unigene FG627652 |
Acc. | FG627652 |
Internal Acc. | TOBESTR074G11 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-48; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=7e-45; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=9e-37; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=2e-35; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=2e-29; |
Length | 532 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_023330; |
Sequence | ATGTGTTACTAACCGAAAGGGAGGGAGGTCGAGCATTTCAAAACCTATCTCTATCGTTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |