| Detail of EST/Unigene FG629956 |
| Acc. | FG629956 |
| Internal Acc. | TOBESTR101H04 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-56; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-56; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=8e-56; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-55; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=1e-55; |
| Length | 380 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_023330; |
| Sequence | CCATCAAAAAACACTTCTTTCTCCTTATTAAACCATGGCTGCTTCTACAATGGCTCTCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |