Detail of EST/Unigene FG636596 |
Acc. | FG636596 |
Internal Acc. | TT-17_J10 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=7e-88; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=2e-87; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=7e-87; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=7e-85; |
Length | 598 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_LTRI3; |
Sequence | TTCTCTAACAGGAGAATCAGCCATAAAACTCACCATCAGAACCATGGAAATGTGGAGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817548 |
Trichome-related Gene from Literature | N/A |