Detail of EST/Unigene FS382285 |
Acc. | FS382285 |
Internal Acc. | FS382285 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=8e-48; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=6e-46; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=2e-26; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=3e-26; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=4e-25; |
Length | 416 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954; |
Sequence | GAGCCTGAGAAGAGGGAAGATAGAGATAGCAGCTTAAGCAAAATAGCAATGGCAACTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |